pLKO.1-puro U6 sgRNA BfuAI large stuffer
(Plasmid #52628)

• Purpose: lentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiency
• Depositing Lab: Scot Wolfe
• Publication: Improved U6-sgRNA vector for expression (unpublished)

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 7145
• Total vector size (bp): 8195
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kanamycin cassette
• Species: Bacterial origin
• Insert Size (bp): 1050
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTGACGTAGAAAGTAATAATTTC
• 3′ sequencing primer: CCTCGAGCCGCGGCCAAAG

Resource Information

• Supplemental Documents:
  • 52628
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a second generation plasmid that increases the efficiency of sgRNA guide cloning over the original "pLKO.1-puro U6 sgRNA BspMI stuffer" vector.

"pLKO.1-puro U6 sgRNA BfuAI large stuffer" was created to simplify the cloning of the sgRNA guide cassette into pLKO.1-puro U6 sgRNA BspMI stuffer vector originally described in the manuscript “Kearns, NA, etal. Development 2014, 141(1):219-23”. The original vector has a small intervening sequence that presents two problems: 1) the efficiency of excision by BfuAI is moderate, and 2) the size of this spacer is similar to the guide sequence, which makes distinguishing positive clones from reclosures challenging. Consequently, we have inserted a Kanamycin cassette between these sites at a unique Bcl1 site. This element is more efficiently excised by BfuAI and makes distinguishing vectors containing the desired guide sequence easy to distinguish from the parent vector. The excision of the Kan cassette by BfuAI cuts this cassette into 3 fragments due to two internal BfuAI sites within the Kan cassette. Otherwise the cloning of the guides is carried out as described in the manuscript.