Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHAGE EF1α dCas9-KRAB
(Plasmid #50919)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50919 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 50919-LV Virus (1 mL at titer > 5x10⁵ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE
  • Total vector size (bp) 12860
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4460
  • Mutation
    D10A, H840A
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • 3xHA (C terminal on insert)
    • KRAB (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Ef1alpha-F 5'-TCAAGCCTCAGACAGTGGTTC-3'
  • 3′ sequencing primer WPRE-R 5'-CATAGCGTAAAAGGAGCAACA-3'
  • (Common Sequencing Primers)

Resource Information

Information for Lentiviral Prep (Catalog # 50919-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from pHAGE EF1α dCas9-KRAB (#50919). In addition to the viral particles, you will also receive purified pHAGE EF1α dCas9-KRAB plasmid DNA.

Delivery

  • Volume 1 mL
  • Titer 5x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 50919-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the puromycin-resistance gene and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: Puro-F2 CTCGGCTTCACCGTCACC
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of protein expression: A549 cells were transduced with an MOI of 1 or 10 of 50919-LV, treated with puromycin and polyclonal pools of puromycin-resistant cells expanded. Cells collected, lysed, and tested for dCas9 expression via immunoblotting. Note: Cas9 expression was only detected at an MOI of 10. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/ml, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers. To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE EF1α dCas9-KRAB was a gift from Rene Maehr & Scot Wolfe (Addgene plasmid # 50919)
  • For your References section:

    Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. 10.1242/dev.103341 PubMed 24346702