pHR-SFFV-KRAB-dCas9-P2A-mCherry
(Plasmid #60954)

• Purpose: 2nd Generation Lentiviral vector. Expresses an N-terminal KRAB-dCas9 fusion protein and mCherry
• Depositing Lab: Jonathan Weissman
• Publication: Gilbert et al Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9.

Backbone

• Vector backbone: pHR
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 14247
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAB-dCas9-P2A-mCherry fusion
• Species: H. sapiens (human)
• Insert Size (bp): 5244
• Promoter: SFFV
• Tags / Fusion Proteins:
  • KRAB domain (N terminal on insert)
  • HA (C terminal on insert)
  • 2x NLS (C terminal on insert)
  • mCherry

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcttcccgagctctataaaagag
• 3′ sequencing primer: CCAGAGGTTGATTATCGATAAGC

Resource Information

• Supplemental Documents:
  • pHR-SFFV-KRAB-dCas9-P2A-mCherry
• A portion of this plasmid was derived from a plasmid made by: The Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
• Articles Citing this Plasmid:
  • 54 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid contains a different promoter compared to the inducible KRAB-dCas9-P2A-mCherry construct described in Figure 5A of the associated publication (Gilbert et al., 2014). To create an inducible version of KRAB-dCas9-P2A-mCherry, subclone the insert into a backbone with an inducible promoter, such as pTRE3G.

For stable expression of KRAB-dCas9 as described in Gilbert et al., 2014, please see pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid #46911).