pGL3-hsp82
(Plasmid
#52909)
-
PurposeDrosophila pseudoobscura hsp82 promoter driving firefly luciferase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 52909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4786
- Total vector size (bp) 5779
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDrosophila pseudoobscura hsp82 promoter
-
SpeciesDrosophila pseudoobscura
-
Insert Size (bp)992
- Promoter D pseudoobscura hsp82
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer ataggctgtccccagtgcaagt
- 3′ sequencing primer tttcatagcttctgccaaccgaacgg (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-hsp82 was a gift from Zach Adelman (Addgene plasmid # 52909 ; http://n2t.net/addgene:52909 ; RRID:Addgene_52909) -
For your References section:
Germline excision of transgenes in Aedes aegypti by homing endonucleases. Aryan A, Anderson MA, Myles KM, Adelman ZN. Sci Rep. 2013;3:1603. doi: 10.1038/srep01603. 10.1038/srep01603 PubMed 23549343