Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-hsp82
(Plasmid #52909)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52909 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4786
  • Total vector size (bp) 5779
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Drosophila pseudoobscura hsp82 promoter
  • Species
    Drosophila pseudoobscura
  • Insert Size (bp)
    992
  • Promoter D pseudoobscura hsp82

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer ataggctgtccccagtgcaagt
  • 3′ sequencing primer tttcatagcttctgccaaccgaacgg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-hsp82 was a gift from Zach Adelman (Addgene plasmid # 52909 ; http://n2t.net/addgene:52909 ; RRID:Addgene_52909)
  • For your References section:

    Germline excision of transgenes in Aedes aegypti by homing endonucleases. Aryan A, Anderson MA, Myles KM, Adelman ZN. Sci Rep. 2013;3:1603. doi: 10.1038/srep01603. 10.1038/srep01603 PubMed 23549343