Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #52910)


Item Catalog # Description Quantity Price (USD)
Plasmid 52910 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6460
  • Total vector size (bp) 6844
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number


  • Gene/Insert name
    Luciferase duplication-TALEN recognition sites
  • Insert Size (bp)
  • Promoter Ae aegypti polyubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATTACTCAAGCGTTTCCTCGT
  • 3′ sequencing primer cgaacaccacggtaggctgcga
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-PUb-SSA was a gift from Zach Adelman (Addgene plasmid # 52910 ; ; RRID:Addgene_52910)
  • For your References section:

    TALEN-based gene disruption in the dengue vector Aedes aegypti. Aryan A, Anderson MA, Myles KM, Adelman ZN. PLoS One. 2013;8(3):e60082. doi: 10.1371/journal.pone.0060082. Epub 2013 Mar 21. 10.1371/journal.pone.0060082 PubMed 23555893