-
Purposehuman MEK1 with MBP and HIS tags, with Ser218 and Ser222 changed to amber codons, for use in phosphoprotein synthesis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCRT7
-
Backbone manufacturerRinehart lab, Addgene plasmid 52053
- Total vector size (bp) 6001
-
Vector typeBacterial Expression ; phosphoprotein synthesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMEK1
-
Alt namemitogen-activated protein kinase kinase 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1198
-
MutationCodon optimized for E.coli, both codons for Ser218 and Ser222 were changed to amber codons
-
Entrez GeneMAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
- Promoter pLtetO
-
Tags
/ Fusion Proteins
- MBP (N terminal on insert)
- HIS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer MBP-F GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer T7 terminal (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCRT7 tetR pLtetO MBP-MEK1 XX Amp was a gift from Jesse Rinehart (Addgene plasmid # 53225 ; http://n2t.net/addgene:53225 ; RRID:Addgene_53225)