Chicken Mermaid S188
(Plasmid #53617)

• Purpose: Genetically encoded voltage sensor based on mUKG-mKOk FRET pair
• Depositing Lab: Vincent Pieribone
• Publication: Han et al PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 5694
• Total vector size (bp): 7614
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chicken Mermaid S188
• Alt name: Gg-VSD Mermaid S188
• Species: G. gallus (chicken), Synthetic
• Insert Size (bp): 1920
• Mutation: Gg-VSP contains an R153Q mutation and an amino acid E (GAG) was introduced immediately after the start M (ATG); Gg-VSP is truncated at S189 (S188 in the native Gg-VSP sequence) and the FRET fluorescent protein pair from the voltage probe Mermaid is fused to the C-terminal (after S189).
• GenBank ID: XP_417079.2
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AGCTGTATGAGAATGCGGTTGC
• 3′ sequencing primer: ATGTCCCTCGTAAGGTCTGCCTGTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The FRET pair present in this probe was derived from the Mermaid voltage sensor (Tsutsui et al., 2008). Tsutsui H, Karasawa S, Okamura Y, Miyawaki A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods 5: 683–685, 2008.
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The chicken voltage sensitive phosphatase (VSP) sequence used in this construct contains an E14K mutation, when compared to the reference sequence XP_417079.2. This mutation could be polymorphism at the site or a PCR error. The depositing laboratory states that the plasmid functions as described in the associated publication.