Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #53693)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 53693 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9100
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    nucleotide sequence 1083-1086 is mutated to TTCG
  • GenBank ID
  • Entrez Gene
    RECK (a.k.a. ST15)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-RECK-3'UTR-miR-21-mut was a gift from Edward Chan (Addgene plasmid # 53693)
  • For your References section:

    Keratinization-associated miR-7 and miR-21 regulate tumor suppressor reversion-inducing cysteine-rich protein with kazal motifs (RECK) in oral cancer. Jung HM, Phillips BL, Patel RS, Cohen DM, Jakymiw A, Kong WW, Cheng JQ, Chan EK. J Biol Chem. 2012 Aug 24;287(35):29261-72. doi: 10.1074/jbc.M112.366518. Epub 2012 Jul 2. 10.1074/jbc.M112.366518 PubMed 22761427