This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-PTEN 3'UTR
(Plasmid #28104)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28104 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Promoter
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5010
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN 3'UTR
  • Alt name
    phosphatase and tensin homolog
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2700
  • Entrez Gene
    Pten (a.k.a. 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1)

Cloning Information

Resource Information

Depositor Comments

Note that Addgene's sequencing result contains a 3 nucleotide deletion (bp# 7639-7641) when compared with GenBank accession number NM_008960.2

PTEN 3'UTR was amplified from Balb/c mouse genomic DNA with the following primer pairs:
F: 5' GCTAGCCCCCCTCCTTG
R: 5' GCTAGCAAAAATAATGAACCTTTTTAATTGTTTAAAGG

PCR products were digested with NheI and subcloned into the XbaI site of the pGL3-promoter vector (Promega)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-PTEN 3'UTR was a gift from Jeffrey Rosen (Addgene plasmid # 28104 ; http://n2t.net/addgene:28104 ; RRID:Addgene_28104)
  • For your References section:

    A putative role for microRNA-205 in mammary epithelial cell progenitors. Greene SB, Gunaratne PH, Hammond SM, Rosen JM. J Cell Sci. 2010 Feb 15. 123(Pt 4):606-18. 10.1242/jcs.056812 PubMed 20103531