Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #53697)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 53697 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 8200
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    Human papillomavirus
  • Insert Size (bp)
  • Mutation
    Mutation in miR-375 binding site m1 (refer to citation)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
  • 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMiR-HPV16-E7-m1 was a gift from Edward Chan (Addgene plasmid # 53697 ; ; RRID:Addgene_53697)
  • For your References section:

    miR-375 activates p21 and suppresses telomerase activity by coordinately regulating HPV E6/E7, E6AP, CIP2A, and 14-3-3zeta. Jung HM, Phillips BL, Chan EK. Mol Cancer. 2014 Apr 8;13(1):80. doi: 10.1186/1476-4598-13-80. 10.1186/1476-4598-13-80 PubMed 24708873