pMiR-CIP2A-miR-375-mutA
(Plasmid
#53706)
-
PurposeLuciferase reporter assay for CIP2A with point mutation on miR-375 binding site
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMiR-Target
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 9200
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCIP2A
-
Alt namep90
-
Alt nameKIAA1524
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1300
-
MutationMutation on miR-375 binding site A (refer to citation)
-
GenBank IDNM_020890.2
-
Entrez GeneCIP2A (a.k.a. KIAA1524, NOCIVA, p90)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMiR-CIP2A-miR-375-mutA was a gift from Edward Chan (Addgene plasmid # 53706 ; http://n2t.net/addgene:53706 ; RRID:Addgene_53706) -
For your References section:
Tumor suppressor miR-375 regulates MYC expression via repression of CIP2A coding sequence through multiple miRNA-mRNA interactions. Jung HM, Patel RS, Phillips BL, Wang H, Cohen DM, Reinhold WC, Chang LJ, Yang LJ, Chan EK. Mol Biol Cell. 2013 Jun;24(11):1638-48, S1-7. doi: 10.1091/mbc.E12-12-0891. Epub 2013 Apr 3. 10.1091/mbc.E12-12-0891 PubMed 23552692
Map uploaded by the depositor.