CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA (Construct 22)
(Plasmid
#55199)
-
PurposeCFP reporter along with FF4 miRNA binding sites and 28 nt sequences
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 55199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL2-Luc (Addgene #26280)
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4856
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameECFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1144
-
GenBank IDKJ796505
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC
- 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Please see http://www.rle.mit.edu/sbg/resources/ for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMVp-ECFP-Triplex-28-8xmiRNA-BS-28-pA (Construct 22) was a gift from Timothy Lu (Addgene plasmid # 55199 ; http://n2t.net/addgene:55199 ; RRID:Addgene_55199) -
For your References section:
Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. 10.1016/j.molcel.2014.04.022 PubMed 24837679