Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p201N 1510
(Plasmid #55771)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55771 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pPZP
  • Backbone size (bp) 6200
  • Modifications to backbone
    Inclusion of aph gene for bacterial selection on kanamycin.
  • Vector type
    RNAi
  • Promoter GmUbi
  • Selectable markers
    G418, kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGAGATTGCTTCAGATCCGTA
  • 3′ sequencing primer CCATTTCCATTTCACAGTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p201N 1510 was a gift from Wayne Parrott (Addgene plasmid # 55771 ; http://n2t.net/addgene:55771 ; RRID:Addgene_55771)
  • For your References section:

    Simple gene silencing using the trans-acting siRNA pathway. Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. 10.1111/pbi.12362 PubMed 25816689