Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #57818)


Item Catalog # Description Quantity Price (USD)
Plasmid 57818 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    S. pyogenes
  • Insert Size (bp)
  • Promoter EFS
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Nhei (not destroyed)
  • 5′ sequencing primer ATAAGTGCAGTAGTCGCCGTG
  • 3′ sequencing primer AAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Sp sgRNA scaffold
  • Insert Size (bp)
  • Promoter hU6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PpuMI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTTGCTGTACTTTCTATAGTG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Alt name
    short EF1alpha Promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGT ACA GTG CAG GGG AAA GAA TA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TACGAGACACGGATCGACCTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Use BsmBI sites for sgRNA cloning. Note that this plasmid does NOT contain the 1.9kb stuffer from the pLKO.005 vector backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL-CRISPR.EFS.GFP was a gift from Benjamin Ebert (Addgene plasmid # 57818 ; ; RRID:Addgene_57818)
  • For your References section:

    Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. 10.1038/nbt.2951 PubMed 24952903