Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #58220)


Item Catalog # Description Quantity Price (USD)
Plasmid 58220 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4799
  • Total vector size (bp) 6404
  • Modifications to backbone
    Duplicate mitochondria targeting sequence.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    green fluorescent calcium-measuring organelle-entrapped protein indicator for the mitochondria (low affinity variant)
  • Species
  • Insert Size (bp)
  • Mutation
    GCaMP2 N263Y E282V E334D M339L F395W D436E
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg-
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV CEPIA4mt was a gift from Masamitsu Iino (Addgene plasmid # 58220 ; ; RRID:Addgene_58220)
  • For your References section:

    Imaging intraorganellar Ca(2+) at subcellular resolution using CEPIA. Suzuki J, Kanemaru K, Ishii K, Ohkura M, Okubo Y, Iino M. Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153. 10.1038/ncomms5153 PubMed 24923787