Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACU
(Plasmid #58373)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58373 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUAST
  • Modifications to backbone
    The attB fragment isolated from pAttB by SalI digestion was inserted into the NdeI site of pUAST by blunt ligation.
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tactccacctcacccatctg
  • 3′ sequencing primer atgatggaccagatgggtgag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACU was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58373 ; http://n2t.net/addgene:58373 ; RRID:Addgene_58373)
  • For your References section:

    Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han C, Jan LY, Jan YN. Proc Natl Acad Sci U S A. 2011 May 23. ():. 10.1073/pnas.1106386108 PubMed 21606367