pACU
(Plasmid
#58373)
-
Purpose(Empty Backbone) UAS vector to express gene of interest in Drosophila
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUAST
-
Modifications to backboneThe attB fragment isolated from pAttB by SalI digestion was inserted into the NdeI site of pUAST by blunt ligation.
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tactccacctcacccatctg
- 3′ sequencing primer atgatggaccagatgggtgag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACU was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58373 ; http://n2t.net/addgene:58373 ; RRID:Addgene_58373) -
For your References section:
Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han C, Jan LY, Jan YN. Proc Natl Acad Sci U S A. 2011 May 23. ():. 10.1073/pnas.1106386108 PubMed 21606367