1
Plasmid 31223: pACU2
  • None

  • pUAST
    (Search Vector Database)

  • Insect Expression

  • 9367

  • EcoRI

  • No

  • XbaI

  • No

  • TCTTACTGACATCCACTTTGCC List of Sequencing Primers

  • GGCGCACAGAAATGATTACAAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Yuh-Nung Jan

  • MTA

Comments: 

A modified pUAST vector containing both P-elements and attB site for high expression of UAS-driven transgenes

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han et al (Proc Natl Acad Sci U S A. 2011 May 23. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31223" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only