pACU2
(Plasmid #31223)

• Purpose: (Empty Backbone)
• Depositing Lab: Yuh-Nung Jan
• Publication: Han et al Proc Natl Acad Sci U S A. 2011 May 23. ():.

Backbone

• Vector backbone: pUAST
• Backbone size (bp): 9367
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TCTTACTGACATCCACTTTGCC
• 3′ sequencing primer: GGCGCACAGAAATGATTACAAC

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A modified pUAST vector containing both P-elements and attB site for high expression of UAS-driven transgenes