Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pACUH
(Plasmid #58374)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58374 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACU
  • Backbone manufacturer
    Chun Han (Addgene plasmid 58373)
  • Backbone size (bp) 9199
  • Modifications to backbone
    Contains 10xUAS-Hsp70-MCS-SV40 (1268bp) cloned into BamHI site.
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ttgattaacccttagcatgtcc
  • 3′ sequencing primer ttcagtgatgtccagtgcag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACUH was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58374 ; http://n2t.net/addgene:58374 ; RRID:Addgene_58374)
  • For your References section:

    Phosphatidylserine Externalization Results from and Causes Neurite Degeneration in Drosophila. Sapar ML, Ji H, Wang B, Poe AR, Dubey K, Ren X, Ni JQ, Han C. Cell Rep. 2018 Aug 28;24(9):2273-2286. doi: 10.1016/j.celrep.2018.07.095. 10.1016/j.celrep.2018.07.095 PubMed 30157423