-
PurposeAn AAV vector that expresses nuclear localized eYFP under control of the c-fos promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepOTTC476
-
Backbone manufacturerOTTC/NIDA
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNuclear-localized Enhanced Yellow Fluorescent Protein
-
Alt nameEYFP
- Promoter mFos
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer mFos prom F1098 AGGACTTGTCTGAGCGCGTG
- 3′ sequencing primer WPRE R1 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC589 - pAAV c-fos Nuc-eYFP was a gift from Brandon Harvey (Addgene plasmid # 59133 ; http://n2t.net/addgene:59133 ; RRID:Addgene_59133) -
For your References section:
Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies. Richie CT, Whitaker LR, Whitaker KW, Necarsulmer J, Baldwin HA, Zhang Y, Fortuno L, Hinkle JJ, Koivula P, Henderson MJ, Sun W, Wang K, Smith JC, Pickel J, Ji N, Hope BT, Harvey BK. J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2. 10.1016/j.jneumeth.2017.03.020 PubMed 28380331