-
PurposeAAV-mediated expression of tdTomato (codon diversified) under the CAG promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | |
AAV1 | 59462-AAV1 | Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. | |||
AAV2 | 59462-AAV2 | Virus (100 µL at titer ≥ 4×10¹² vg/mL) and Plasmid. | |||
AAV5 | 59462-AAV5 | Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. | |||
AAV8 | 59462-AAV8 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | |||
AAV9 | 59462-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | |||
AAV Retrograde | 59462-AAVrg | Virus (100µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | |||
AAV PHP.S | 59462-PHP.S | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | |||
AAV PHP.eB | 59462-PHPeB | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV with CAG promter
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 4719
- Total vector size (bp) 6150
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 at 30C (use carbenicillin if using Stbl3) OR DH5a at 37C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Insert Size (bp)1431
-
Mutationcodon diversified
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gctctagagcctctgctaacc
- 3′ sequencing primer gcagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is completely sequenced by depositing lab except for parts of both ITRs and a part of the CAG promoter. Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.
Information for AAV1 (Catalog # 59462-AAV1) ( Back to top )
Purpose
Ready-to-use AAV1 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 5×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV2 (Catalog # 59462-AAV2) ( Back to top )
Purpose
Ready-to-use AAV2 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 4×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV2
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV5 (Catalog # 59462-AAV5) ( Back to top )
Purpose
Ready-to-use AAV5 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 5×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV8 (Catalog # 59462-AAV8) ( Back to top )
Purpose
Ready-to-use AAV8 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV8
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV9 (Catalog # 59462-AAV9) ( Back to top )
Purpose
Ready-to-use AAV9 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV Retrograde (Catalog # 59462-AAVrg) ( Back to top )
Purpose
Ready-to-use AAV Retrograde particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
tdTomato expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.Data submitted about 59462-AAVrg by requesting scientist(s):
Information for AAV PHP.S (Catalog # 59462-PHP.S) ( Back to top )
Purpose
Ready-to-use AAV PHP.S particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV were produced with the PHP.S serotype, which permits efficient transduction of the peripheral nervous system. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
-
Packaging Plasmids
encode adenoviral helper sequences and AAV rep gene, PHP.S cap gene
pUCmini-iCAP-PHP.S (plasmid #103006) - Buffer PBS + 0.001% Pluronic F-68
- Serotype PHP.S (plasmid #103006)
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Citation Information: When using the PHP.S serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.Data submitted about 59462-PHP.S by requesting scientist(s):
Information for AAV PHP.eB (Catalog # 59462-PHPeB) ( Back to top )
Purpose
Ready-to-use AAV PHP.eB particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.
CAG-driven tdTomato expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
-
Packaging Plasmids
encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
pUCmini-iCAP-PHP.eB (plasmid #103005) - Buffer PBS + 0.001% Pluronic F-68
- Serotype PHPeB (plasmid #103005)
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (codon diversified)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.Data submitted about 59462-PHPeB by requesting scientist(s):
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-tdTomato (codon diversified) was a gift from Edward Boyden (Addgene plasmid # 59462 ; http://n2t.net/addgene:59462 ; RRID:Addgene_59462)
For viral preps, please replace (Addgene plasmid # 59462) in the above sentence with: (Addgene viral prep # 59462-AAV1), (Addgene viral prep # 59462-AAV2), (Addgene viral prep # 59462-AAV5), (Addgene viral prep # 59462-AAV8), (Addgene viral prep # 59462-AAV9), (Addgene viral prep # 59462-AAVrg), (Addgene viral prep # 59462-PHP.S), or (Addgene viral prep # 59462-PHPeB)