Human SOX17 sgRNA
(Plasmid
#59725)
-
PurposePlasmid encoding sgRNA to generate SOX17 knock-out mutant human cells
-
Depositing Lab
-
Publication
-
Sequence Information
-
Depositor Sequences: Partial (1)
-
Addgene Sequences: Partial (1)
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 59725 | Plasmid sent as bacteria in agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx330
-
Backbone manufacturerFeng Zhang
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehSox17 sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer TGGCCTTTTGCTCACATGTG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human SOX17 sgRNA was a gift from Jacob Hanna (Addgene plasmid # 59725) -
For your References section:
SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate. Naoko Irie, Leehee Weinberger, Walfred W.C. Tang, Toshihiro Kobayashi, Sergey Viukov, Yair S. Manor, Sabine Dietmann, Jacob H. Hanna, M. Azim Surani. Cell 160, 1–16, January 15, 2015 10.1016/j.cell.2014.12.013