Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Human SOX17 sgRNA
(Plasmid #59725)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59725 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSox17 sgRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TGGCCTTTTGCTCACATGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human SOX17 sgRNA was a gift from Jacob Hanna (Addgene plasmid # 59725 ; http://n2t.net/addgene:59725 ; RRID:Addgene_59725)
  • For your References section:

    SOX17 is a critical specifier of human primordial germ cell fate. Irie N, Weinberger L, Tang WW, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, Surani MA. Cell. 2015 Jan 15;160(1-2):253-68. doi: 10.1016/j.cell.2014.12.013. Epub 2014 Dec 24. 10.1016/j.cell.2014.12.013 PubMed 25543152