Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-APPL1-ΔPTB
(Plasmid #59768)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59768 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRES2
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    APPL1
  • Species
    H. sapiens (human)
  • Mutation
    deleted amino acids 467-709
  • GenBank ID
    NM_012096.2
  • Entrez Gene
    APPL1 (a.k.a. APPL, DIP13alpha, MODY14)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tcgaattcggcttatgccgg
  • 3′ sequencing primer taggtacccaggctgatcttcacacac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-APPL1-ΔPTB was a gift from Donna Webb (Addgene plasmid # 59768 ; http://n2t.net/addgene:59768 ; RRID:Addgene_59768)
  • For your References section:

    The endosomal adaptor protein APPL1 impairs the turnover of leading edge adhesions to regulate cell migration. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM, Webb DJ. Mol Biol Cell. 2012 Apr;23(8):1486-99. doi: 10.1091/mbc.E11-02-0124. Epub 2012 Feb 29. 10.1091/mbc.E11-02-0124 PubMed 22379109