APPL1-N308D-GFP
(Plasmid
#102783)
-
PurposePoint mutation in APPL1 that diminishes its interaction with Rab5
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-C3
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPPL1
-
SpeciesH. sapiens (human)
-
Mutationchanged asparagine 308 to aspartate; *(see below)
-
GenBank IDNM_012096.2
-
Entrez GeneAPPL1 (a.k.a. APPL, DIP13alpha, MODY14)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer EGFP-C 5'd[CATGGTCCTGCTGGAGTTCGTG]
- 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note: Addgene's quality control sequencing finds additional residues KPNSAVDGTAGPGSTGSR appended to the C-terminus of the APPL1 protein. These additional residues are not thought to affect protein function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
APPL1-N308D-GFP was a gift from Donna Webb (Addgene plasmid # 102783 ; http://n2t.net/addgene:102783 ; RRID:Addgene_102783)