Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59945)


Item Catalog # Description Quantity Price (USD)
Plasmid 59945 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dihydropterine reductase
  • Alt name
  • Insert Size (bp)
  • Promoter pTrc

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer AACTATCCGCTGGATGACCA
  • 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pterin-4a-carbinolamine dehydratase
  • Alt name
  • Insert Size (bp)
  • Promoter pTrc

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer AACTATCCGCTGGATGACCA
  • 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbE1k-2 was a gift from Taek Soon Lee (Addgene plasmid # 59945 ; ; RRID:Addgene_59945)
  • For your References section:

    Engineering of L-tyrosine oxidation in Escherichia coli and microbial production of hydroxytyrosol. Satoh Y, Tajima K, Munekata M, Keasling JD, Lee TS. Metab Eng. 2012 Nov;14(6):603-10. doi: 10.1016/j.ymben.2012.08.002. Epub 2012 Aug 29. 10.1016/j.ymben.2012.08.002 PubMed 22948011