This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59990)


Item Catalog # Description Quantity Price (USD)
Plasmid 59990 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Modifications to backbone
    Mutated BsaI sites in backbone
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Ebf.774 (F+E) sgRNA
  • Promoter Ciinte.U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer cccaagcgagtgtttgttac
  • 3′ sequencing primer GGATTTCCTTACGCGAAATACG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

U6 promoter based on Nishiyama, A. and Fujiwara, S. (2008). RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo. Dev. growth … 521–529.

sgRNA F+E scaffold based on Chen, B., Gilbert, L. a, Cimini, B. a, Schnitzbauer, J., Zhang, W., Li, G.-W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–91.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6>Ebf.774(F+E) was a gift from Lionel Christiaen (Addgene plasmid # 59990 ; ; RRID:Addgene_59990)
  • For your References section:

    Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740