This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60140)


Item Catalog # Description Quantity Price (USD)
Plasmid 60140 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5261
  • Total vector size (bp) 5840
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Species
    oplophorus gracilirostris
  • Insert Size (bp)
  • Promoter MET17pr
  • Tag / Fusion Protein
    • Nuclear localization signal (NLS) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer cactttatgcttccggctcctatgtt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB648 was a gift from Nicolas Buchler (Addgene plasmid # 60140)
  • For your References section:

    "Measuring fast gene dynamics in single cells with timelapse luminescence microscopy". Mazo-Vargas A, Park H, Aydin M, Buchler NE. Mol Biol Cell. 2014 Sep 17. pii: mbc.E14-07-1187. 10.1091/mbc.E14-07-1187 PubMed 25232010