pNB648
(Plasmid
#60140)
-
PurposeNanoLuc luciferase with a nuclear localization signal (NLS) driven by MET17 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep406
- Backbone size w/o insert (bp) 5261
- Total vector size (bp) 5840
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLuc
-
Alt nameNanoLuc
-
Alt namep406-MET17pr-NLS-NLuc
-
Speciesoplophorus gracilirostris
-
Insert Size (bp)579
- Promoter MET17pr
-
Tag
/ Fusion Protein
- Nuclear localization signal (NLS) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer cactttatgcttccggctcctatgtt
- 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNB648 was a gift from Nicolas Buchler (Addgene plasmid # 60140 ; http://n2t.net/addgene:60140 ; RRID:Addgene_60140) -
For your References section:
"Measuring fast gene dynamics in single cells with timelapse luminescence microscopy". Mazo-Vargas A, Park H, Aydin M, Buchler NE. Mol Biol Cell. 2014 Sep 17. pii: mbc.E14-07-1187. 10.1091/mbc.E14-07-1187 PubMed 25232010