This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNB697
(Plasmid #60146)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60146 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIS385
  • Backbone size w/o insert (bp) 5480
  • Total vector size (bp) 7247
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3 ; LYS2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RdLuc
  • Alt name
    Red beetle luciferase
  • Alt name
    pIS385-MET17pr-NLS-RdLuc-ssrA
  • Species
    Synthetic
  • Insert Size (bp)
    1767
  • Promoter MET17pr
  • Tags / Fusion Proteins
    • Nuclear localization signal (NLS) (N terminal on insert)
    • ClpXP degron (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer TCTAGAACTAGTGGATC
  • 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATAAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB697 was a gift from Nicolas Buchler (Addgene plasmid # 60146)
  • For your References section:

    "Measuring fast gene dynamics in single cells with timelapse luminescence microscopy". Mazo-Vargas A, Park H, Aydin M, Buchler NE. Mol Biol Cell. 2014 Sep 17. pii: mbc.E14-07-1187. 10.1091/mbc.E14-07-1187 PubMed 25232010