Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-FLEX-VAMP2:HRP
(Plasmid #60659)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60659 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV-FLEX
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 1379
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    VAMP2:HRP
  • Alt name
    Sbv2:HRP
  • Species
    B. taurus (bovine), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • 3′ sequencing primer CTGACAACGGGCCACAACTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ege Kavalali provided the VAMP2 and the HRP cDNA
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-VAMP2:HRP was a gift from Scott Sternson (Addgene plasmid # 60659 ; http://n2t.net/addgene:60659 ; RRID:Addgene_60659)
  • For your References section:

    A genetically specified connectomics approach applied to long-range feeding regulatory circuits. Atasoy D, Betley JN, Li WP, Su HH, Sertel SM, Scheffer LK, Simpson JH, Fetter RD, Sternson SM. Nat Neurosci. 2014 Dec;17(12):1830-9. doi: 10.1038/nn.3854. Epub 2014 Nov 2. 10.1038/nn.3854 PubMed 25362474