Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCAS
(Plasmid #60847)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60847 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    2-micron/pUC
  • Total vector size (bp) 8761
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    G418

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    S. pyogenese Cas9
  • Species
    streptococcus pyogenes
  • Insert Size (bp)
    4104
  • Tag / Fusion Protein
    • NLS/His8 (C terminal on insert)

Gene/Insert 2

  • Gene/Insert name
    RNA pol III promoter (tRNA-Tyr)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    132

Gene/Insert 3

  • Gene/Insert name
    hepatitis delta virus ribozyme, genomic
  • Species
    hepatitis delta virus
  • Mutation
    L4 is UUCG tetraloop
  • Tag / Fusion Protein
    • TTT 3' extension prior to sgRNA

Gene/Insert 4

  • Gene/Insert name
    sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    100
  • Mutation
    guide targets LYP1 (CATAATAACGTCCAATAAAT)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAS was a gift from Jamie Cate (Addgene plasmid # 60847 ; http://n2t.net/addgene:60847 ; RRID:Addgene_60847)
  • For your References section:

    Selection of chromosomal DNA libraries using a multiplex CRISPR system. Ryan OW, Skerker JM, Maurer MJ, Li X, Tsai JC, Poddar S, Lee ME, DeLoache W, Dueber JE, Arkin AP, Cate JH. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703. 10.7554/eLife.03703 PubMed 25139909