-
PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone2-micron/pUC
- Total vector size (bp) 8761
-
Vector typeBacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameS. pyogenese Cas9
-
Speciesstreptococcus pyogenes
-
Insert Size (bp)4104
-
Tag
/ Fusion Protein
- NLS/His8 (C terminal on insert)
Gene/Insert 2
-
Gene/Insert nameRNA pol III promoter (tRNA-Tyr)
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)132
Gene/Insert 3
-
Gene/Insert namehepatitis delta virus ribozyme, genomic
-
Specieshepatitis delta virus
-
MutationL4 is UUCG tetraloop
-
Tag
/ Fusion Protein
- TTT 3' extension prior to sgRNA
Gene/Insert 4
-
Gene/Insert namesgRNA
-
SpeciesSynthetic
-
Insert Size (bp)100
-
Mutationguide targets LYP1 (CATAATAACGTCCAATAAAT)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAS was a gift from Jamie Cate (Addgene plasmid # 60847 ; http://n2t.net/addgene:60847 ; RRID:Addgene_60847) -
For your References section:
Selection of chromosomal DNA libraries using a multiplex CRISPR system. Ryan OW, Skerker JM, Maurer MJ, Li X, Tsai JC, Poddar S, Lee ME, DeLoache W, Dueber JE, Arkin AP, Cate JH. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703. 10.7554/eLife.03703 PubMed 25139909