pXCas9H840A
(Plasmid
#60900)
-
Purpose(Empty Backbone) Dual Expression Vector for Cas9 H840A nickase and gRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60900 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC ori vector
- Backbone size (bp) 8506
-
Vector typeMammalian Expression, CRISPR
- Promoter CBh and U6
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid is generated by introduction of the H840A mutation into pX330 from the Zhang laboratory.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gRNA cloning strategy is exactly the same as for pX330/pX335.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXCas9H840A was a gift from Bruce Conklin (Addgene plasmid # 60900 ; http://n2t.net/addgene:60900 ; RRID:Addgene_60900) -
For your References section:
Systematic quantification of HDR and NHEJ reveals effects of locus, nuclease, and cell type on genome-editing. Miyaoka Y, Berman JR, Cooper SB, Mayerl SJ, Chan AH, Zhang B, Karlin-Neumann GA, Conklin BR. Sci Rep. 2016 Mar 31;6:23549. doi: 10.1038/srep23549. 10.1038/srep23549 PubMed 27030102
