1
Plasmid 42230: pX330-U6-Chimeric_BB-CBh-hSpCas9
  • A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.

  • humanized S. pyogenes Cas9

  • SpCas9

  • hSpCas9

  • 4272

  • 3xFLAG

  • N terminal on insert

  • pUC ori vector
    (Search Vector Database)

  • Mammalian Expression, CRISPR

  • CBh

  • AgeI

  • No

  • EcoRI

  • No

  • agggatggttggttggtggg List of Sequencing Primers

  • CCAATCCTCCCCCTTGCTGT

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (8)
  • View map

  • pX330 annotated Genbank file (application/octet-stream)

  • Feng Zhang

  • UBMTA

Comments: 

Alternate plasmid name: pSpCas9(BB) (PX330)

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information, please see the following web page: http://crispr.genome-engineering.org

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong et al (Science. 2013 Jan 3. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 42230" in your Materials and Methods section.