pX330-U6-Chimeric_BB-CBh-hSpCas9
(Plasmid #42230)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Alternate plasmid name: pSpCas9(BB) (PX330)

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information, please see the following web page: http://crispr.genome-engineering.org

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230)
  • For your References section:

    Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718