Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #42230)

  • Purpose
    A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.
  • Depositing Lab
  • Price
    $65 (USD)
    Shipped as bacteria in an agar stab at ambient temperature
Add to Cart
Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
  • Alt name
  • Insert Size (bp)
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Alternate plasmid name: pSpCas9(BB) (PX330)

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information, please see the following web page:

For more information on Zhang Lab CRISPR Plasmids please refer to:

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230)
  • For your References section:

    Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718