pCITF-KCC2
(Plasmid #61404)

• Purpose: Mammalian expression vector for human KCC2 under CAG promoter. Coexpression of TdTomato with IRES sequence
• Depositing Lab: Franck Polleux
• Publication: Bortone et al Neuron. 2009 Apr 16;62(1):53-71. doi: 10.1016/j.neuron.2009.01.034.

Backbone

• Vector backbone: pCITF
• Backbone size w/o insert (bp): 6900
• Total vector size (bp): 10292
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KCC2
• Alt name: SLC12A5
• Species: H. sapiens (human)
• Insert Size (bp): 3351
• GenBank ID: AAG43493.1 AF208159.1
• Entrez Gene: SLC12A5 (a.k.a. EIEE34, EIG14, KCC2, hKCC2)
• Promoter: CAG
• Tag / Fusion Protein:
  • IRES-tdTomato-Flag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: CTACAGCTCCTGGGCAACGT
• 3′ sequencing primer: CGGCTTCGGCCAGTAACG

Resource Information

• Supplemental Documents:
  • pCITF-KCC2 annotated sequence
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry