Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61447)


Item Catalog # Description Quantity Price (USD)
Plasmid 61447 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    E. coli
  • Promoter pLacO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAAGAAACCATTATTATCATGAC
  • 3′ sequencing primer GGGCGGCGGATTTGTCCTAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFF530 was a gift from Timothy Lu (Addgene plasmid # 61447 ; ; RRID:Addgene_61447)
  • For your References section:

    Synthetic biology. Genomically encoded analog memory with precise in vivo DNA writing in living cell populations. Farzadfard F, Lu TK. Science. 2014 Nov 14;346(6211):1256272. doi: 10.1126/science.1256272. 10.1126/science.1256272 PubMed 25395541