Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEF5-FRT-TagRFP-T-IFT88
(Plasmid #61684)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61684 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF5-FRT-DEST
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFT88
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2474
  • GenBank ID
    BC012250.1
  • Entrez Gene
    Ift88 (a.k.a. AW552028, Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
  • Promoter EF1a
  • Tag / Fusion Protein
    • TagRFP.T (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GTTCGAAGGTAAGCCTATCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF5-FRT-TagRFP-T-IFT88 was a gift from Maxence Nachury (Addgene plasmid # 61684 ; http://n2t.net/addgene:61684 ; RRID:Addgene_61684)
  • For your References section:

    Single molecule imaging reveals a major role for diffusion in the exploration of ciliary space by signaling receptors. Ye F, Breslow DK, Koslover EF, Spakowitz AJ, Nelson WJ, Nachury MV. Elife. 2013 Aug 6;2:e00654. doi: 10.7554/eLife.00654. Print 2013. 10.7554/eLife.00654 PubMed 23930224