Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61726)


Item Catalog # Description Quantity Price (USD)
Plasmid 61726 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Mutation
    Two silent mutations to ensure restriction site compatibility
  • GenBank ID
  • Entrez Gene
    SNRNP70 (a.k.a. RNPU1Z, RPU1, SNRP70, Snp1, U1-70K, U170K, U1AP, U1RNP)
  • Promoter T-REx (CMV + 2xTetO2)
  • Tag / Fusion Protein
    • mSA (monomeric streptavidin) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTC GTT TAG TGA ACC GTC AG
  • 3′ sequencing primer AGATGGCTGGCAACTAGAAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINTO-NSA::hSNRNP70 was a gift from Roberto Bonasio (Addgene plasmid # 61726 ; ; RRID:Addgene_61726)
  • For your References section:

    In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790