-
PurposeExpress wild-type mouse histone demethylase Kdm2b
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61739 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTY
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKdm2b
-
SpeciesM. musculus (mouse)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer attctcaagcctcagacagtgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTY-EF1a-wild type mKdm2b-Flag was a gift from Yi Zhang (Addgene plasmid # 61739 ; http://n2t.net/addgene:61739 ; RRID:Addgene_61739) -
For your References section:
Kdm2b maintains murine embryonic stem cell status by recruiting PRC1 complex to CpG islands of developmental genes. He J, Shen L, Wan M, Taranova O, Wu H, Zhang Y. Nat Cell Biol. 2013 Apr;15(4):373-84. doi: 10.1038/ncb2702. Epub 2013 Mar 17. 10.1038/ncb2702 PubMed 23502314
Map uploaded by the depositor.