This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62726)


Item Catalog # Description Quantity Price (USD)
Plasmid 62726 Plasmid sent as bacteria in agar stab 1 $65
AAV8 62726-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    original from Stratagene
  • Backbone size w/o insert (bp) 4368
  • Total vector size (bp) 6789
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Stigeoclonium helveticum channelrhodopsin-tdTomato
  • Alt name
  • Species
    Stigeoclonium helveticum
  • Insert Size (bp)
  • GenBank ID
  • Promoter human synapsin promoter
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

Information for AAV8 (Catalog # 62726-AAV8) ( Back to top )


Ready-to-use AAV8 particles produced from pAAV-Syn-Chronos-tdTomato (#62726). In addition to the viral particles, you will also receive purified pAAV-Syn-Chronos-tdTomato plasmid DNA.

Syn-driven Chronos-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR or digital droplet PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by digital droplet PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by SYPRO Red staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-Chronos-tdTomato was a gift from Edward Boyden (Addgene plasmid # 62726)

    For viral preps, please replace (Addgene plasmid # 62726) in the above sentence with: (Addgene viral prep # 62726-AAV8)

  • For your References section:

    Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633