This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CAG-ArchT-tdTomato
(Plasmid #29778)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 29778 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV with CAG promoter
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 6259
  • Vector type
    Mammalian Expression, AAV ; Adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli (Stbl3, XL-10, Sure2 et.al), grow at 30C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ArchT-tdTomato
  • Alt name
    archaerhodopsin
  • Alt name
    archaerhodopsin TP009
  • Alt name
    ArchT
  • Species
    H. strain TP009
  • Insert Size (bp)
    744
  • Mutation
    N/A
  • Tag / Fusion Protein
    • tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gctctagagcctctgctaacc
  • 3′ sequencing primer gcagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-ArchT-tdTomato was a gift from Edward Boyden (Addgene plasmid # 29778)
  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444