Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22222)


Item Catalog # Description Quantity Price (USD)
Plasmid 22222 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, AAV, Cre/Lox ; adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3), grow at 30C
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
    H. sodomense archaerhodopsin-3
  • Species
    H. sodomense
  • Insert Size (bp)
  • Mutation
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer CCCATAACTTCGTATAATGTATGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


In the map below, the Selected Features list should be labeled as follows (instead of the 3 loxP sites listed from 3629-3692 and 5299-5403):

lox2272: 3629-3596 , loxp: 3725-3692

lox2272: 5266-5399 , loxp: 5370-5403

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-Arch-GFP was a gift from Edward Boyden (Addgene plasmid # 22222)
  • For your References section:

    High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY, Han X, Dobry AS, Qian X, Chuong AS, Li M, Henninger MA, Belfort GM, Lin Y, Monahan PE, Boyden ES. Nature. 2010 Jan 7. 463(7277):98-102. 10.1038/nature08652 PubMed 20054397