Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22222)


Item Catalog # Description Quantity Price (USD)
Plasmid 22222 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 22222-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
AAV9 22222-AAV9 Back-ordered
Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, AAV, Cre/Lox ; adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3), grow at 30C
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
    H. sodomense archaerhodopsin-3
  • Species
    H. sodomense
  • Insert Size (bp)
  • Mutation
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer CCCATAACTTCGTATAATGTATGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


In the map below, the Selected Features list should be labeled as follows (instead of the 3 loxP sites listed from 3629-3692 and 5299-5403):

lox2272: 3629-3596 , loxp: 3725-3692

lox2272: 5266-5399 , loxp: 5370-5403

Information for AAV1 (Catalog # 22222-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from AAV-FLEX-Arch-GFP (#22222). In addition to the viral particles, you will also receive purified AAV-FLEX-Arch-GFP plasmid DNA.

CAG-driven cre-dependent Arch-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.6% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV9 (Catalog # 22222-AAV9) ( Back to top )


Ready-to-use AAV9 particles produced from AAV-FLEX-Arch-GFP (#22222). In addition to the viral particles, you will also receive purified AAV-FLEX-Arch-GFP plasmid DNA.

CAG-driven cre-dependent Arch-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.6% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Data submitted about 22222-AAV9 by requesting scientist(s):

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-Arch-GFP was a gift from Edward Boyden (Addgene plasmid # 22222 ; ; RRID:Addgene_22222)

    For viral preps, please replace (Addgene plasmid # 22222) in the above sentence with: (Addgene viral prep # 22222-AAV1) or (Addgene viral prep # 22222-AAV9)

  • For your References section:

    High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY, Han X, Dobry AS, Qian X, Chuong AS, Li M, Henninger MA, Belfort GM, Lin Y, Monahan PE, Boyden ES. Nature. 2010 Jan 7. 463(7277):98-102. 10.1038/nature08652 PubMed 20054397