Holiday Schedule: Addgene will be closed December 23rd & 26th and December 30th & January 2nd. For details, see our holiday shipping schedule. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #18917)


Item Catalog # Description Quantity Price (USD)
Plasmid 18917 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5340
  • Vector type
    AAV, Cre/Lox ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
  • Copy number
    Low Copy


  • Gene/Insert name
    Channelrhodopsin 2-tdtomato
  • Alt name
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Tag / Fusion Protein
    • tdtomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence. Please see Reviews in the right column for an image of Addgene's digest with these enzymes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-rev-ChR2-tdtomato was a gift from Scott Sternson (Addgene plasmid # 18917)
  • For your References section:

    A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range circuit mapping. Atasoy D, Aponte Y, Su HH, Sternson SM. J Neurosci. 2008 Jul 9. 28(28):7025-30. 10.1523/JNEUROSCI.1954-08.2008 PubMed 18614669