1
Plasmid 18916: AAV-FLEX-rev-ChR2(H134R)-mCherry
  • Channelrhodopsin 2-mCherry

  • ChR2

  • 1677

  • Chlamydomonas reinhardtii

  • mCherry

  • C terminal on insert

  • H134R

  • AAV2
    (Search Vector Database)

  • Cre/Lox ; Adeno-Associated Virus

  • 5340

  • Spe1

  • Yes

  • Spe1

  • Yes

  • CTGTGGCTGCGTGAAAGCCTTG List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 30

  • Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media

  • Low Copy

  • Karl Deisseroth, Stanford University

  • View sequences (2)
  • View map

  • SmaI digest (application/pdf)

  • Scott Sternson

  • MTA
    Clontech Limited Use Label License

Comments: 

Note: We now recommend the AAV-FLEX-ChR2tdtomato-rev construct. It shows less clumping relative to ChR2 labeled with mCherry.

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A FLEX switch targets Channelrhodopsin-2 to multiple cell types for imaging and long-range circuit mapping. Atasoy et al (J Neurosci. 2008 Jul 9. 28(28):7025-30. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18916" in your Materials and Methods section.