Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pAAV-Ef1a-DIO eNpHR 3.0-EYFP
(Plasmid #26966)

Item Catalog # Description Quantity Price (USD)
Plasmid 26966 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

  • Gene/Insert name
    eNpHR 3.0
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    ER export at 3' end of gene. Trafficking signal (TS) in between gene and fluorophore.
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggccagcttggcacttgatg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the human elongation factor-1a promoter. Golgi export trafficking signal (TS) sequence is KSRITSEGEYIPLDQIDINV. ER export sequence is FCYENEV.

For additional information please visit -

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO eNpHR 3.0-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26966)
  • For your References section:

    Molecular and cellular approaches for diversifying and extending optogenetics. Gradinaru V, Zhang F, Ramakrishnan C, Mattis J, Prakash R, Diester I, Goshen I, Thompson KR, Deisseroth K. Cell. 2010 Apr 2. 141(1):154-65. 10.1016/j.cell.2010.02.037 PubMed 20303157