Plasmid 26966: pAAV-Ef1a-DIO eNpHR 3.0-EYFP
  • AAV expression of eNpHR 3.0 fused to EYFP driven by EF1a promoter for optogenetic inhibition

  • eNpHR 3.0

  • 1683

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • ER export at 3' end of gene. Trafficking signal (TS) in between gene and fluorophore.

  • pAAV
    (Search Vector Database)

  • Mammalian Expression

  • 5609

  • AscI

  • No

  • NheI

  • No

  • ggccagcttggcacttgatg List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

    Ancillary Agreement for Plasmids Containing FP Materials


This plasmid contains the human elongation factor-1a promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Molecular and cellular approaches for diversifying and extending optogenetics. Gradinaru et al (Cell. 2010 Apr 2. 141(1):154-65. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26966" in your Materials and Methods section.