pAAV-Ef1a-DIO EYFP
(Plasmid #27056)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5603
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    EYFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    720

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggccagcttggcacttgatg
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the human elongation factor-1a promoter.

For additional information please visit - http://www.optogenetics.org

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO EYFP was a gift from Karl Deisseroth (Addgene plasmid # 27056)