1
Plasmid 27056: pAAV-Ef1a-DIO EYFP
  • EYFP

  • 720

  • H. sapiens (human)

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5603

  • AscI

  • No

  • NheI

  • No

  • ggccagcttggcacttgatg List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

This plasmid contains the human elongation factor-1a promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 27056" in your Materials and Methods section.