Modified Shipping Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 23 - 27. If you have any questions, please contact us at

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #26968)

Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5587
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl3 (rec A-) cells to avoid recombinations with the LTRs
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    E123T, H134R
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggccagcttggcacttgatg
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the human elongation factor-1a promoter.

For additional information please visit -

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO ChETA-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26968)
  • For your References section:

    Ultrafast optogenetic control. Gunaydin LA, Yizhar O, Berndt A, Sohal VS, Deisseroth K, Hegemann P. Nat Neurosci. 2010 Mar . 13(3):387-92. 10.1038/nn.2495 PubMed 20081849