Plasmid 26968: pAAV-Ef1a-DIO ChETA-EYFP
  • AAV expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by EF1a promoter for optogenetic activation

  • hChR2(E123T/H134R)-EYFP


  • 1662

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • E123T, H134R

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5587

  • AscI

  • No

  • NheI

  • No

  • ggccagcttggcacttgatg List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • Stbl3 (rec A-) cells to avoid recombinations with the LTRs

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

    Ancillary Agreement for Plasmids Containing FP Materials


This plasmid contains the human elongation factor-1a promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Ultrafast optogenetic control. Gunaydin et al (Nat Neurosci. 2010 Mar . 13(3):387-92. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26968" in your Materials and Methods section.