pLenti-CaMKIIa-ChETA-EYFP
(Plasmid #26967)

• Purpose: 3rd gen lentiviral expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by CaMKIIa promoter for optogenetic activation
• Depositing Lab: Karl Deisseroth
• Publication: Gunaydin et al Nat Neurosci. 2010 Mar . 13(3):387-92.
• Sequence Information:

  • Depositor Sequences: Full (1)
  • Addgene Sequences: Partial (6)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	26967	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart

Available to Academic and Nonprofits Only

Backbone

• Vector backbone: pLenti
  (Search Vector Database)
• Backbone size w/o insert (bp): 9250
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3 (rec A-) cells to avoid recombinations with the LTRs
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hChR2(E123T/H134R)-EYFP
• Alt name: ChETA-EYFP
• Species: H. sapiens (human)
• Insert Size (bp): 1662
• Mutation: E123T
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctcagaagccccaagctcgtc
• 3′ sequencing primer: GCAATAGCATGATACAAAGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• Terms and Licenses:
  • UBMTA
  • Institut Pasteur Label License for cPPT
  • Ancillary Agreement for Plasmids Containing FP Materials
• Articles Citing this Plasmid:
  • 3 References

Depositor Comments

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org