Plasmid 26967: pLenti-CaMKIIa-ChETA-EYFP
  • 3rd gen lentiviral expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by CaMKIIa promoter for optogenetic activation

  • hChR2(E123T/H134R)-EYFP


  • 1662

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • E123T

  • pLenti
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 9250

  • BamHI, AgeI

  • No

  • EcoRI

  • No

  • ctcagaagccccaagctcgtc List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • Stbl3 (rec A-) cells to avoid recombinations with the LTRs

  • High Copy

  • View sequences (3)
  • View map

  • View map

  • Notes from Addgene (2)

  • Karl Deisseroth

    Ancillary Agreement for Plasmids Containing FP Materials


This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Ultrafast optogenetic control. Gunaydin et al (Nat Neurosci. 2010 Mar . 13(3):387-92. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26967" in your Materials and Methods section.