pLenti-CaMKIIa-ChETA-EYFP
(Plasmid #26967)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9250
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3 (rec A-) cells to avoid recombinations with the LTRs
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    hChR2(E123T/H134R)-EYFP
  • Alt name
    ChETA-EYFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1662
  • Mutation
    E123T
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctcagaagccccaagctcgtc
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CaMKIIa-ChETA-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26967)
  • For your References section:

    Ultrafast optogenetic control. Gunaydin LA, Yizhar O, Berndt A, Sohal VS, Deisseroth K, Hegemann P. Nat Neurosci. 2010 Mar . 13(3):387-92. 10.1038/nn.2495 PubMed 20081849