1
Plasmid 26971: pAAV-CaMKIIa-eNpHR 3.0-EYFP
  • AAV expression of eNpHR 3.0 fused to EYFP driven by CaMKIIa promoter for optogenetic inhibition

  • eNpHR 3.0

  • 1683

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • Trafficking Signal (TS) ER Export Signal

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5332

  • BamHI, AgeI

  • No

  • EcoRI, HinDIII

  • No

  • ctcagaagccccaagctcgtc List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3 (rec A-) cells to avoid recombinations with the LTRs

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26971" in your Materials and Methods section.