Plasmid 26971: pAAV-CaMKIIa-eNpHR 3.0-EYFP
  • AAV expression of eNpHR 3.0 fused to EYFP driven by CaMKIIa promoter for optogenetic inhibition

  • eNpHR 3.0

  • 1683

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • Trafficking Signal (TS) ER Export Signal

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5332

  • BamHI, AgeI

  • No

  • EcoRI, HinDIII

  • No

  • ctcagaagccccaagctcgtc List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • Stbl3 (rec A-) cells to avoid recombinations with the LTRs

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

    Ancillary Agreement for Plasmids Containing FP Materials


This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26971" in your Materials and Methods section.