1
Plasmid 26969: pAAV-CaMKIIa-hChR2(H134R)-EYFP
  • AAV expression of humanized ChR2(H134R) fused to EYFP driven by CaMKIIa promoter for optogenetic activation

  • hChR2(H134R)

  • ChR2

  • 1662

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • Histidine 134 is mutated to Arginine

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5390

  • BamHI, SalI, KpnI

  • No

  • EcoRI, HinDIII

  • No

  • ctcagaagccccaagctcgtc List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3 (rec A-) cells to avoid recombinations with the LTRs

  • High Copy

  • View sequences (3)
  • View map

  • View map

  • Karl Deisseroth

  • MTA

Comments: 

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Global and local fMRI signals driven by neurons defined optogenetically by type and wiring. Lee et al (Nature. 2010 Jun 10. 465(7299):788-92. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26969" in your Materials and Methods section.