(Plasmid #26969)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5390
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl3 (rec A-) cells to avoid recombinations with the LTRs
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Histidine 134 is mutated to Arginine
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, SalI, KpnI (not destroyed)
  • 3′ cloning site EcoRI, HinDIII (not destroyed)
  • 5′ sequencing primer ctcagaagccccaagctcgtc
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit -

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26969)
  • For your References section:

    Global and local fMRI signals driven by neurons defined optogenetically by type and wiring. Lee JH, Durand R, Gradinaru V, Zhang F, Goshen I, Kim DS, Fenno LE, Ramakrishnan C, Deisseroth K. Nature. 2010 Jun 10. 465(7299):788-92. 10.1038/nature09108 PubMed 20473285