This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #26969)


Item Catalog # Description Quantity Price (USD)
Plasmid 26969 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5390
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Stbl3 (rec A-) cells to avoid recombinations with the LTRs
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Histidine 134 is mutated to Arginine
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI, SalI, KpnI (not destroyed)
  • 3′ cloning site EcoRI, HinDIII (not destroyed)
  • 5′ sequencing primer ctcagaagccccaagctcgtc
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter.

For additional information please visit -

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 26969)
  • For your References section:

    Global and local fMRI signals driven by neurons defined optogenetically by type and wiring. Lee JH, Durand R, Gradinaru V, Zhang F, Goshen I, Kim DS, Fenno LE, Ramakrishnan C, Deisseroth K. Nature. 2010 Jun 10. 465(7299):788-92. 10.1038/nature09108 PubMed 20473285