1
Plasmid 26973: pAAV-hSyn-hChR2(H134R)-EYFP
  • AAV expression of humanized ChR2 with H134R mutation fused to EYFP driven by human Synapsin I promoter for optogenetic activation

  • hChR2(H134R)

  • 1662

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • H134R

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 4574

  • BamHI, SalI, KpnI

  • No

  • EcoRI, HinDIII

  • No

  • ccacgcgaggcgcgagatag List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Annotated GenBank file (application/octet-stream)

  • Karl Deisseroth

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

This plasmid contains the human synapsin I promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26973" in your Materials and Methods section.