1
Plasmid 26973: pAAV-hSyn-hChR2(H134R)-EYFP
  • hChR2(H134R)

  • 1662

  • H. sapiens (human)

  • EYFP

  • C terminal on insert

  • H134R

  • pAAV
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 4574

  • BamHI, SalI, KpnI

  • No

  • EcoRI, HinDIII

  • No

  • ccacgcgaggcgcgagatag List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • Please use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.

  • High Copy

  • View sequences (4)
  • View map

  • View map

  • Karl Deisseroth

  • MTA

Comments: 

This plasmid contains the human synapsin I promoter.

For additional information please visit - http://www.optogenetics.org

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26973" in your Materials and Methods section.