-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 29777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
AAV1 | 29777-AAV1 | Viral service discontinued. |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV with CAG promoter
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 5451
-
Vector typeMammalian Expression, AAV ; Adeno-associated virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsUse recombinase-free E. coli (Stbl3, XL-10, Sure2 et.al), grow at 30C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameArchT-GFP
-
Alt namearchaerhodopsin
-
Alt namearchaerhodopsin TP009
-
Alt nameArchT
-
SpeciesH. strain TP009
-
Insert Size (bp)744
-
MutationN/A
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gctctagagcctctgctaacc
- 3′ sequencing primer gcagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.
Information for AAV1 (Catalog # 29777-AAV1) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
Viral service discontinued.
Purpose
Ready-to-use AAV1 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.
CAG-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume .
- Titer ≥ 1×10¹³ vg/mL
- Pricing $350 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene GFP
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-ArchT-GFP was a gift from Edward Boyden (Addgene plasmid # 29777 ; http://n2t.net/addgene:29777 ; RRID:Addgene_29777)
For viral preps, please replace (Addgene plasmid # 29777) in the above sentence with: (Addgene viral prep # 29777-AAV1)
-
For your References section:
A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444