This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CAG-ArchT-GFP
(Plasmid #29777)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 29777 Plasmid sent as bacteria in agar stab 1 $65
Add to Cart
AAV1 29777-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380
Add to Cart
AAV5 29777-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380
Add to Cart
AAV9 29777-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380
Add to Cart

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV with CAG promoter
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5451
  • Vector type
    Mammalian Expression, AAV ; Adeno-associated virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use recombinase-free E. coli (Stbl3, XL-10, Sure2 et.al), grow at 30C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ArchT-GFP
  • Alt name
    archaerhodopsin
  • Alt name
    archaerhodopsin TP009
  • Alt name
    ArchT
  • Species
    H. strain TP009
  • Insert Size (bp)
    744
  • Mutation
    N/A
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gctctagagcctctgctaacc
  • 3′ sequencing primer gcagcgtatccacatagcg
    • (Common Sequencing Primers)

Resource Information

Depositor Comments

PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Information for AAV1 (Catalog # 29777-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR or droplet digital PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by droplet digital PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 29777-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR or droplet digital PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by droplet digital PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 29777-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR or droplet digital PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by droplet digital PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-ArchT-GFP was a gift from Edward Boyden (Addgene plasmid # 29777)

    For viral preps, please replace (Addgene plasmid # 29777) in the above sentence with: (Addgene viral prep # 29777-AAV1), (Addgene viral prep # 29777-AAV5), or (Addgene viral prep # 29777-AAV9)

  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444
Related items:
Commonly requested with: