pAAV-CAG-ArchT-GFP
(Plasmid #29777)

• Depositing Lab: Edward Boyden
• Publication: Han et al Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	29777	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart
AAV1	29777-AAV1	Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Add to Cart
AAV5	29777-AAV5	Limited Stock Available, 4 units left Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Add to Cart
AAV9	29777-AAV9	Please see plasmid 99039 or 22222 for an alternative.	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Discontinued

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: AAV with CAG promoter
  (Search Vector Database)
• Backbone manufacturer: Scott Sternson
• Backbone size w/o insert (bp): 5451
• Vector type: Mammalian Expression, AAV ; Adeno-associated virus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use recombinase-free E. coli (Stbl3, XL-10, Sure2 et.al), grow at 30C
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ArchT-GFP
• Alt name: archaerhodopsin
• Alt name: archaerhodopsin TP009
• Alt name: ArchT
• Species: H. strain TP009
• Insert Size (bp): 744
• Mutation: N/A
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gctctagagcctctgctaacc
• 3′ sequencing primer: gcagcgtatccacatagcg

Resource Information

• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Articles Citing this Plasmid:
  • 10 References

Depositor Comments

PLEASE CONTACT ED BOYDEN () FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Information for AAV1 (Catalog # 29777-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV5 (Catalog # 29777-AAV5)

Purpose

Ready-to-use AAV5 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 29777-AAV9)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Please see plasmid 99039 or 22222 for an alternative.

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-ArchT-GFP (#29777). In addition to the viral particles, you will also receive purified pAAV-CAG-ArchT-GFP plasmid DNA.

CAG-driven ArchT-GFP expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: .
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $350 USD for preparation of . virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

This viral item has been discontinued. Please see pAAV-CamKII-ArchT-GFP (PV2527) (Addgene 99039-AAV9) or AAV-FLEX-Arch-GFP (Addgene 22222-AAV9) for an alternative.