Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62729)


Item Catalog # Description Quantity Price (USD)
Plasmid 62729 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5637
  • Total vector size (bp) 6516
  • Modifications to backbone
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Deletion of periplasmic signal domain
  • Promoter T7
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATCGAGATCTCGATCCCGCG
  • 3′ sequencing primer TTTCAGCAAAAAACCCCTCAAGACC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Beta-Lactamase was a gift from Niels Geijsen (Addgene plasmid # 62729 ; ; RRID:Addgene_62729)
  • For your References section:

    Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214